Última hora
Consiga un 40% de descuento 0
🔎 Descubre las acciones preferidas de Warren Buffett que baten al S&P 500 en un +174,3% Consigue un 40% de descuento
Cerrar

Apple Inc (AAPL)

Crear alerta
Nuevo
Crear alerta
Página web
  • Como notificación de alerta
  • Para utilizar esta opción, debe iniciar sesión
Aplicación móvil
  • Para utilizar esta opción, debe iniciar sesión
  • Asegúrese de iniciar sesión con el mismo usuario con que creó la alerta

Condición de la alerta

Frecuencia

Una vez
%

Frecuencia

Frecuencia

Modo de recepción de la alerta

Estado

Añadir/Eliminar de la cartera Añadir a cartera
Añadir a mi lista de seguimiento
Añadir posición

Posición añadida con éxito a:

Introduzca un nombre para su cartera de posiciones
 
3.058,89 -20,03    -0,65%
01/03 - Mercado cerrado. Valores en MXN ( Aviso legal )
  • Volumen: 18.409
  • Compra/Venta: 3.057,00 / 3.065,01
  • Rango día: 3.017,52 - 3.070,99
Tipo:  Acción
Mercado:  México
ISIN:  US0378331005 
S/N:  037833100
Apple 3.058,89 -20,03 -0,65%

Flujo de caja AAPL

 
Se presenta aquí el estado de flujo de caja de Apple Inc (Apple), indicando los cambios en el efectivo y los equivalentes de efectivo de la empresa, divididos en actividades operativas, de inversión y de financiación de cada uno de los últimos 4 periodos (trimestral o anual). Seleccione los parámetros que más le interesen con el fin de personalizar el gráfico debidamente.
AnualTrimestral
InvestingPro Estado de flujo de caja avanzado
Período terminado: 2023
30/12
2023
30/09
2023
01/07
2023
01/04
Período: 0 meses 0 meses 0 meses 0 meses
Resultado consolidado del ejercicio 33916 22956 19881 24160
Flujos de efectivo de las actividades de explotación 39895 21598 26380 28560
Depreciación 2848 2653 3052 2898
Amortización - - - -
Impuestos diferidos - - - -
Otros ajustes 2008 2049 2698 1271
Ingresos en efectivo - - - -
Pagos en efectivo - - - -
Cobros y (pagos) por impuestos sobre beneficios 7255 11659 2126 4066
Pago de intereses - 1213 717 1170
Depósitos de entidades de crédito 1123 -6060 749 231
Flujos de efectivo de las actividades de inversión 1927 2394 437 2319
Pagos de activos de las actividades de inversión -2392 -2163 -2093 -2916
Otros flujos de efectivo de las actividades de inversión 4319 4557 2530 5235
Flujos de efectivo de las actividades de financiación -30585 -23153 -24048 -25724
Otros pagos relacionados con actividades de financiación -46 -73 -53 -66
Distribución de dividendos -3825 -3758 -3849 -3650
Adquisición de instrumentos de capital propio -22730 -21315 -19863 -20012
Pasivos subordinados -3984 1993 -283 -1996
Efecto de las variaciones de los tipos de cambio - - - -
Variación neta del efectivo y equivalentes 11237 839 2769 5155
Saldo de efectivo a la apertura 29523 29126 25639 19532
Saldo de efectivo al cierre 40760 29965 28408 24687
Flujo de caja libre 33200,12 11682,38 20443 21864,5
Crecimiento del flujo de caja libre 184,19 -42,85 -6,5 -22,44
Rendimiento del flujo de caja libre 1,26 0,728 0,798 0,985
* En millones de USD (excepto para los elementos por acción)
InvestingPro
Ir al Panel de control InvestingPro

Desbloquee el acceso a más de 1000 métricas con InvestingPro

Vea información avanzada sobre el estado de flujo de caja, incluyendo tasas de crecimiento y métricas que proporcionan una visión en profundidad del rendimiento financiero histórico y previsto de la empresa.

 
Guía para comentarios

Desde Investing.com España le invitamos a que interactúe con otros usuarios y comparta con ellos sus puntos de vista y sus dudas en relación con el mercado. Sin embargo, para que el debate sea lo más enriquecedor posible, por favor, le rogamos que tenga en cuenta los siguientes criterios:

  • Aporte valor a la conversación: Transmita sus conocimientos reales sobre el mercado. Si dispone de información técnica o razones contrastadas sobre los comentarios que vierte en el foro, por favor, añádalas también. Recuerde que hay usuarios que sí deciden operar en real en base a comentarios publicados en el foro.
  • Céntrese en el tema a tratar y contribuya al debate con información de interés. Recuerde que somos una página de información económica y bursátil, por lo que no daremos cabida a comentarios de índole política, religiosa o social. 
  • Sea respetuoso: Rebata cualquier argumento de forma constructiva y diplomática. Queremos ante todo conversaciones objetivas y que se centren en el tema/instrumento a debatir en cuestión. 
  • Cuide la redacción: Vigile la puntuación, las mayúsculas y las tildes. Solo se permitirán comentarios en castellano. Se pueden eliminar comentarios en otros idiomas o dialectos, comentarios cuyo contenido no sea comprensible o comentarios en mayúsculas.
  • Evite comentarios irreverentes, difamatorios o ataques personales contra otros autores o usuarios. Pueden suponer la suspensión automática de la cuenta.
  • Cuidado a la hora de elegir un nombre para su cuenta: Se suspenderán aquellas cuentas que utilicen los nombres de personalidades conocidas o intenten suplantar la identidad de otros usuarios, así como aquellas cuentas que incumplan de manera reiterada las normas del foro. No se permitirán tampoco nombres o nicknames inapropiados o promocionales.
  • NOTA: El spam, los mensajes promocionales y los enlaces serán eliminados de sus comentarios. Enlaces a grupos de Facebook, Telegram, WhatsApp, entre otros, se eliminarán del foro y pueden suponer la suspensión automática de la cuenta. Velamos en todo momento por la protección de datos.

¿Cómo funciona la sección de comentarios?

Todos los comentarios se publican de forma automática siempre y cuando no incumplan ninguna de las normas anteriores. En el momento en el que el sistema detecta una posible “infracción”, el comentario se queda pendiente de revisión, por lo que puede tardar más en aparecer en pantalla (evite duplicar comentarios).

Si el moderador detecta que es un comentario inapropiado procederá a eliminarlo. Si el usuario incide en dicho comportamiento, procederemos a suspender de forma temporal su cuenta y contará como un primer aviso. Si el comportamiento se repite tras el primer aviso, se suspenderá la cuenta de forma definitiva.

Contacte con Soporte Técnico ante cualquier duda que pueda surgirle. Es la única vía de comunicación para tratar estos temas.

Foro de AAPL

Escribe tu comentario sobre Apple Inc
 
¿Estás seguro que quieres borrar este gráfico?
 
Publicar
Publicar también en
 
¿Sustituir el gráfico adjunto por un nuevo gráfico?
1000
En estos momentos no le está permitido dejar comentarios debido a informes negativos de otros usuarios. Su estado será revisado por nuestros moderadores.
Por favor, espere un minuto antes de publicar otro comentario
Muchas gracias por participar en nuestro foro. Su comentario quedará pendiente hasta que nuestros moderadores lo revisen, por lo que puede tardar un tiempo en aparecer publicado.
Sebastián Méndez
Sebastián Méndez Hace 23 minutos
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
💱💱💱La vida es una oportunidad, pero llega para aquellos que tienen mucho entusiasmo para lograrla, no te quedes sentado y mires a otros ganar mucho, solo pruébalo ahora. Envía un mensaje a ¢ath£rin£ Lay1a Ho11oman en F/B, WHTSAP...(+'4475) (2976) (39_27). LLLLLLLLLLHHHHHHHHHH
profCarlos Navarro
profCarlos Navarro Hace 43 minutos
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
La inflación devalúa tus ahorros, obliga a todos a ser inversores. Lo que significa que debe preocuparse o dedicar su tiempo y energía al estudio de oportunidades de inversión, ambas cosas muy costosas. Gracias a (ammyskoda) en ( iiiinsatgarrm )... por mostrarme la forma adecuada de invertir y comerciar con bitcoins con su señal comercial y sus pautas de inversión. Invertir y comerciar son más que simplemente tener habilidades de asistencia técnica. ¡Hay un gran componente de disciplina y madurez emocional en el que hay que trabajar! Tiempo en el mercado versus sincronización del mercado. Si mantienes esa mentalidad como inversor, ¡mantendrás la calma durante la tormenta! En unos meses gané 27 BTC cuando comencé con 5 btc y he seguido por el mismo camino con ammyskoda..) (~~~~~~~~~~~~~~~1313313131113133133133131336143245544555454484848644343313111331614649949797887070854
wizzo wizzo
wizzo wizzo Hace 46 minutos
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
Es cierto que muchas personas subestiman la importancia de los asesores hasta que sus propios sentimientos los agotan. Hace unos veranos, necesitaba un empujón importante para mantener a flote mi empresa. Busqué asesores autorizados y encontré a alguien con calificaciones sobresalientes, coach (Latpoune )en ( iiiiinsatgarrm ). Él ha contribuido a que mi reserva aumente de $27000 a $85000 independientemente de la inflación.~~~~~gagaggagagagagggagagagagaggagagagagagagaggagagagaggagagtatattatatatat
Bobby Jack
Bobby Jack Hace 1 hora
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
Depende completamente de para qué necesitas los $10k. Si es su fondo de emergencia, es una idea terrible ponerlo en el mercado de valores. Si está ahorrando para el pago inicial de una casa, probablemente sea una mejor idea mantenerlo en el banco para evitar posibles pérdidas y mostrar un buen historial de ahorro. Sólo debes ponerlo en bolsa si no lo necesitas durante al menos 5 años y te sientes cómodo con la posibilidad de que pierda. W~pp_(+'4479) (4672) (79_83) ~~~~~~~4737744744747747474474744747474747447474747447447447474744744747474474474774474474447744744474474744744744747447447474747447474447447447447447447447474474744744747474774447
Duran Raúl
Duran Raúl Hace 1 hora
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
Es cierto que muchas personas subestiman la importancia de los asesores hasta que sus propios sentimientos los agotan. Hace unos veranos, necesitaba un empujón importante para mantener a flote mi empresa.uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu Busqué asesores autorizados y encontré a alguien con calificaciones sobresalientes, coachVicenteSantiago en ( iiiiinsatgarrm ). Él ha contribuido a que mi reserva aumente de $27000 a $85000 independientemente de la inflación.nnnnnnnnnnuuuuuuuuuuuuuuuunnnnnnnnnnnnnnnnnnnnn
Giorgio Mancini
Giorgio Mancini Hace 2 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
¡Bitcoin vuelve a 60k! Ahora está claro... En OTC no hay más BTC para comprar, el valor se vuelve cada vez más interesante... Ni siquiera estoy vendiendo a 200k... Será divertido después del halving... Contacta a un profesional para guiarlo en la venta y compra de BTC a tarifas de mercado convenientes y rentables, >> 📲(+6, 1, 4, 8, 9, nueve, 5, 3, 5, 5, 9.,)💯WHTSAP____________'5354, 5 4 3 $78. 941247
Henry Bobby
Henry Bobby Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
Siempre aconsejaré a los principiantes que proporcionen una comprensión básica de las acciones y las criptomonedas. Hendrik realmente se ha hecho un nombre. Invertí $1.000 y obtuve $9.000 en menos de 24 horas. Ella es verdaderamente una obligación de Dios. Conéctalo, W~pp_(+'4479) (4672) (79_83) ~~~~~~~~~~~~~~~4747474747747477474747444744744747477474747474447447447744747447447474447447744747447474474474747444744744744747447574474557474747474744774747747474447744747474744747
Roberto Henry
Roberto Henry Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
Depende completamente de para qué necesitas los $10k. Si es su fondo de emergencia, es una idea terrible ponerlo en el mercado de valores. Si está ahorrando para el pago inicial de una casa, probablemente sea una mejor idea mantenerlo en el banco para evitar posibles pérdidas y mostrar un buen historial de ahorro. Sólo debes ponerlo en bolsa si no lo necesitas durante al menos 5 años y te sientes cómodo con la posibilidad de que pierda. W~pp_(+'4479) (4672) (79_83) ~~~~~~~~~~~4747474747477747477474774747744774477474747474747474747747477447747444774744774744474774774774477477447474744747477477747477477747474477474774774747447447447477747747447474747477744777477477377474747474774447747747477474
TraderEmilia Martín
TraderEmilia Martín Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
zzzzq ..111..¡Excelente curso de inversión en Forex! Ahora tengo un conocimiento básico del comercio y la inversión en criptomonedas. Todo gracias a su ammyskoda en (iiiinsatgarrm)###..., ella lo explica todo en profundidad, incluso para los usuarios avanzados, invirtieron con $4000💵 y ganaron $45000. Así que no importa tu experiencia, ¡siempre hay algo que puedes aprender! No importa si eres un hodler actual o un novato, puedes capitalizar la fluctuación de bitcoin operando con su estrategia/señales...UUUUUUUUUUUUVVVVVVUVUUUUUUUUUUUUEUEUEUEUEUEUEUEUVVUXVXBXCCNCNCNVNVNCNCNNCNCNCCNVNVNNVBBBCBBCBCCBCBCCBCBCNCNNNN
ajn ben
ajn ben Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
8282838838383838383883837373737737¿Está buscando asesoramiento y orientación financiera porque quiere invertir en el mercado pero entre el trabajo y los compromisos familiares simplemente hay poco tiempo? Tengo una cartera de unos 400.000 dólares en este momento, todo en acciones. Cyeisla encendido (iiiinsatgarrm). 838383837377373737376363636363636636363663636363636363636636363636363636636363636363636363663636336
 
¿Estás seguro que quieres borrar este gráfico?
 
Publicar
 
¿Sustituir el gráfico adjunto por un nuevo gráfico?
1000
En estos momentos no le está permitido dejar comentarios debido a informes negativos de otros usuarios. Su estado será revisado por nuestros moderadores.
Por favor, espere un minuto antes de publicar otro comentario
Adjuntar un gráfico al comentario
Confirmar bloqueo

¿Está seguro de que desea bloquear a %USER_NAME%?

Al hacerlo, ni usted ni %USER_NAME% podrán ver las publicaciones del otro en Investing.com.

Se ha agregado correctamente a %USER_NAME% a su lista de usuarios bloqueados

Acaba de desbloquear a esta persona; tiene que esperar 48 horas para poder bloquearla de nuevo.

Denunciar este comentario

Díganos qué piensa de este comentario

Comentario denunciado

Gracias

Su denuncia será examinada por nuestros moderadores
Regístrese con Google
o
Regístrese con su email