Última hora
Consiga un 40% de descuento 0
🚨 ¿Mercados volátiles? Encuentre joyas ocultas para obtener grandes rendimientos Buscar valores ahora
Cerrar

Futuros oro - Jun 2024 (GCM4)

Crear alerta
Nuevo
Crear alerta
Página web
  • Como notificación de alerta
  • Para utilizar esta opción, debe iniciar sesión
Aplicación móvil
  • Para utilizar esta opción, debe iniciar sesión
  • Asegúrese de iniciar sesión con el mismo usuario con que creó la alerta

Condición de la alerta

Frecuencia

Una vez
%

Frecuencia

Frecuencia

Modo de recepción de la alerta

Estado

Añadir/Eliminar de la cartera Añadir a cartera
Añadir a mi lista de seguimiento
Añadir posición

Posición añadida con éxito a:

Introduzca un nombre para su cartera de posiciones
 
2,324.90 -13.50    -0.58%
- Datos derivados en tiempo real. Valores en USD ( Aviso legal )
  • Último cierre: 2,338.40
  • Apertura: 2,328.30
  • Rango día: 2,316.85 - 2,333.85
Tipo:  Materias primas
Grupo:  Metales
Unidades:  1 Onza Troy
Oro 2,324.90 -13.50 -0.58%

Instrumentos relacionados con el Oro

 
Esta página ofrece información sobre ETFs e índices interrelacionados con GC. Para más información, haga clic en los links.

Futuros

Crear alerta
Añadir a cartera
Añadir/Eliminar de la cartera  
Añadir a mi lista de seguimiento
Añadir posición

Posición añadida con éxito a:

Introduzca un nombre para su cartera de posiciones
 
Crear alerta
Nuevo
Crear alerta
Página web
  • Como notificación de alerta
  • Para utilizar esta opción, debe iniciar sesión
Aplicación móvil
  • Para utilizar esta opción, debe iniciar sesión
  • Asegúrese de iniciar sesión con el mismo usuario con que creó la alerta

Condición de la alerta

Frecuencia

Una vez
%

Frecuencia

Frecuencia

Modo de recepción de la alerta

Estado

 NombreMesÚltimoAnteriorMáximoMínimoVar.% Var.Hora
 TOCOM Gold Mini11.453,0011.453,0011.453,0011.453,00-303,00-2,58%23/04 

ETFs

 NombreSímboloÚltimo% Var.Vol.Hora
 SPDR Gold SharesGLD214,65-0,18%5,21M24/04 
 iShares GoldIAU43,85-0,14%5,14M24/04 
 abrdn Physical Gold SharesSGOL22,16-0,18%3,08M24/04 
 ICICI Prudential GoldIPEG62,41+0,14%14,61K05:59:00 
 Istanbul GoldGLDTRf219,10-1,08%660,80K24/04 
 ProShares Ultra GoldUGL78,15-0,36%221,72K24/04 
 ETFS Physical GoldGOLD32,93-0,09%321,19K24/04 
 ProShares UltraShort GoldGLL21,52+0,33%109,39K24/04 
 NewGold DebenturesGLDJ41.634+1,26%82,15K24/04 
 ICICI Prudential GoldIPEG62,40+0,00%024/04 
 UBS Gold USDAUUSI74,82+0,46%36,50K24/04 
 Invesco Physical Gold ETCSGLD224,63+0,34%20,58K24/04 
 Invesco Physical Gold ETCSGLD210,14+0,34%18,11K24/04 
 WisdomTree Physical GoldPHAU218,18+0,45%7,72K24/04 
 SPDR Gold Shares28401.673,00-0,59%4,07K05:43:00 
 Africa GoldETFGLDJ43.471+1,14%357,0024/04 
 SPDR Gold SharesSGLD214,00-0,19%0,09K05:13:00 
 WisdomTree Physical GoldPHAU204,18+0,58%14,05K24/04 
 iShares GoldIAU747,81+0,24%0,75K24/04 
 SPDR Gold Shares132633.240,0-0,39%6,32K05:38:59 
 abrdn Physical Gold SharesSGOL384,16+0,00%017/04 
 Gold Bullion Securities ETCGBS201,17+0,60%4,62K24/04 
 UBS Gold USDAUUSIC.68,22+0,77%1,58K24/04 
 Gold Bullion Securities ETCGBSx214,77+0,35%14,63K24/04 
 Invesco Physical Gold ETCSGLP18.088,50+0,39%2,26K24/04 
 WisdomTree Physical Gold - EUR Daily HedgedGBSE12,830,00%023/04 
 WisdomTree GoldBULL22,55+0,67%1,16K24/04 
 WisdomTree Physical GoldPHAU204,10+0,48%1,35K24/04 
 Gold Bullion Securities ETCOGG9205,770,00%016/04 
 UBS Gold USDAUUSIN1.115,400,00%012/01 
 Invesco Physical Gold ETCSGLD224,05+0,25%0,75K24/04 
 WisdomTree Gold 1x Daily ShortSBUL13,94-0,29%024/04 
 Gold Bullion Securities ETCGBSx199,76-0,14%0,45K24/04 
 Invesco Physical Gold ETCSGLD210,43+0,54%0,83K24/04 
 DB Physical GoldXGLD224,47+0,37%1,50K24/04 
 abrdn Physical Gold Shares0IEE22,16+6,03%0,50K24/04 
 WisdomTree GoldBULL24,05+0,33%8,93K24/04 
 Gold Bullion Securities ETCGG9B200,72+0,42%0,08K24/04 
 Gold Bullion Securities ETCGBSS17.279,50+0,44%0,15K24/04 
 NewGold DebenturesNGLD1.0690,00%0,00K23/04 
 ZKB Gold AA EURZGLDEU2.050,00+0,71%0,40K24/04 
 SPDR Gold SharesSGLD-D291,60-0,17%1,00K05:48:00 
 SPDR Gold SharesGLD3.660,01+0,31%0,48K24/04 
 abrdn Physical Gold SharesEDSG20,75-0,19%024/04 
 Invesco Physical Gold ETC8PSG209,98+0,14%0,04K24/04 
 Raiffeisen Solid Gold Ounces A CHFRGLDO2.022,50+0,22%0,08K24/04 
 SPDR Gold SharesGLD200,42+0,43%024/04 
 BNPP Gold ETCBNQJ202,42+0,41%0,02K24/04 
 iShares GoldBK0H41,11+0,42%024/04 
 Raiffeisen Solid Gold CHF HedgedRGLDSH4.784,00,00%023/04 
 ETFS Physical GoldGB519,84+0,32%024/04 

Índices

 NombreÚltimoMáximoMínimoVar.% Var.Hora
 Gold Futures Long USD1.701,771.710,431.692,02-2,44-0,14%24/04 
 AMEX Gold BUGS Settle259,33259,33259,33+28,84+12,51%19/04 
 Bloomberg Gold Euro Hedged Daily TR620,43622,78618,41-3,50-0,56%05:59:00 
 Bloomberg Gold TR539,09541,18537,37-3,07-0,57%05:59:00 
 Gold x5 Leveraged1.324,5091.359,2751.286,038-10,348-0,78%24/04 
 DJ Commodity Gold805,35805,90803,66-2,11-0,26%05:02:00 
 Bloomberg Gold 3 Month Fwd245,10245,97244,38-1,39-0,57%05:59:00 
 LBMA Gold Fixing Price2.320,252.320,252.320,25-8,20-0,35%24/04 
 Bloomberg Gold230,88231,75230,13-1,33-0,57%05:59:00 

Mis previsiones

Oro: ¿Cuál es su pronóstico?
o
Vote para conocer el sentimiento general
Guía para comentarios

Desde Investing.com España le invitamos a que interactúe con otros usuarios y comparta con ellos sus puntos de vista y sus dudas en relación con el mercado. Sin embargo, para que el debate sea lo más enriquecedor posible, por favor, le rogamos que tenga en cuenta los siguientes criterios:

  • Aporte valor a la conversación: Transmita sus conocimientos reales sobre el mercado. Si dispone de información técnica o razones contrastadas sobre los comentarios que vierte en el foro, por favor, añádalas también. Recuerde que hay usuarios que sí deciden operar en real en base a comentarios publicados en el foro.
  • Céntrese en el tema a tratar y contribuya al debate con información de interés. Recuerde que somos una página de información económica y bursátil, por lo que no daremos cabida a comentarios de índole política, religiosa o social. 
  • Sea respetuoso: Rebata cualquier argumento de forma constructiva y diplomática. Queremos ante todo conversaciones objetivas y que se centren en el tema/instrumento a debatir en cuestión. 
  • Cuide la redacción: Vigile la puntuación, las mayúsculas y las tildes. Solo se permitirán comentarios en castellano. Se pueden eliminar comentarios en otros idiomas o dialectos, comentarios cuyo contenido no sea comprensible o comentarios en mayúsculas.
  • Evite comentarios irreverentes, difamatorios o ataques personales contra otros autores o usuarios. Pueden suponer la suspensión automática de la cuenta.
  • Cuidado a la hora de elegir un nombre para su cuenta: Se suspenderán aquellas cuentas que utilicen los nombres de personalidades conocidas o intenten suplantar la identidad de otros usuarios, así como aquellas cuentas que incumplan de manera reiterada las normas del foro. No se permitirán tampoco nombres o nicknames inapropiados o promocionales.
  • NOTA: El spam, los mensajes promocionales y los enlaces serán eliminados de sus comentarios. Enlaces a grupos de Facebook, Telegram, WhatsApp, entre otros, se eliminarán del foro y pueden suponer la suspensión automática de la cuenta. Velamos en todo momento por la protección de datos.

¿Cómo funciona la sección de comentarios?

Todos los comentarios se publican de forma automática siempre y cuando no incumplan ninguna de las normas anteriores. En el momento en el que el sistema detecta una posible “infracción”, el comentario se queda pendiente de revisión, por lo que puede tardar más en aparecer en pantalla (evite duplicar comentarios).

Si el moderador detecta que es un comentario inapropiado procederá a eliminarlo. Si el usuario incide en dicho comportamiento, procederemos a suspender de forma temporal su cuenta y contará como un primer aviso. Si el comportamiento se repite tras el primer aviso, se suspenderá la cuenta de forma definitiva.

Contacte con Soporte Técnico ante cualquier duda que pueda surgirle. Es la única vía de comunicación para tratar estos temas.

Debates sobre Futuros oro

Escribe tu comentario sobre Futuros oro
 
¿Estás seguro que quieres borrar este gráfico?
 
Publicar
Publicar también en
 
¿Sustituir el gráfico adjunto por un nuevo gráfico?
1000
En estos momentos no le está permitido dejar comentarios debido a informes negativos de otros usuarios. Su estado será revisado por nuestros moderadores.
Por favor, espere un minuto antes de publicar otro comentario
Muchas gracias por participar en nuestro foro. Su comentario quedará pendiente hasta que nuestros moderadores lo revisen, por lo que puede tardar un tiempo en aparecer publicado.
Ramírez Medina
Ramírez Medina _JUST_NOW
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
kkkkkkkkkk_Debes mirar hacia adelante si quieres tener éxito en la vida, por eso es sumamente importante invertir con la experta para mejorar tu nivel de vida de la mejor manera. Obtuve ganancias notables invirtiendo con ella. Con $5,000 recaudé más de $52,000. Todos los principiantes y entusiastas que estén interesados en operar deben enviar un mensaje a Laura*Davis*Carter en ||iiinsxagraxrm para poder operar de manera rentable._lllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllkkkkkkkkkkkklllllllllllkkkk
Íker Blanco
Íker Blanco Hace 2 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
2222222222222222223223222222.Invertir moneda criptográfica ahora debería estar en la lista de personas de todos los tiempos. Dentro de dos o tres años, es posible que te quedes estático con la decisión que tomaste hoy. Agradezco a anna_skodaa en .(lIntstr-agam). He obtenido una rentabilidad de más de $275 000 en 4 meses. Ella se destaca en el desarrollo de estrategias y rentabilidades legítimas, tan perfectas.....333333333333333333333333333333333333333333333333333333333
Lavinia Moraes Moraes
Lavinia Moraes Moraes Hace 2 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy…….. Comencé a ganar cuando conocí a una corredora legítima, Gabriella_Daniel__luz, quien me mostró lo rentable que es su mercado para aquellos que determinan que están ganando. Escuché el testimonio de esta gran comerciante, así que definitivamente decidí intentar invertir $500 aquí y he aquí que obtuvo una ganancia de $5,800, ella realmente está aquí para salvarnos de la prosperidad y darnos un nuevo testimonio, ella es de primera categoría y honestamente está en (iiintst¿~<iragam) puedes masajear allí para obtener más pautas yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy636363737373737377373736362525252525252525352526622626622662627384885857474736266262616161514424252636363535364646464747477388685858575757
Dario Adami
Dario Adami Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
Fcxtcxtcrxtcftctctcgccgcgcgcgctctct,,,,,Sin embargo, no creo que pueda enfrentar ningún problema al tratar con la directora en W@sssssss@PP+44 7427 533752, ella es una ('€comerciante experta) que ha hecho mucho más por cualquiera que Cuando pedí ayuda, fui engañado por los esquivadores y tomaron todos mis preparativos, pero cuando concluí con ella fue fácil para mí recuperarlo todo, así que prometo que cualquiera puede pasar a ella como respaldo..... .....dyddydyydydgcychchgtchvchxhhvhhcgcycyhxyxyxyxycycycgyy
Calvo César
Calvo César Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
...La Sra. anna_skodaa en (lIntstr-agam). es mi administradora de fondos discrecional, dirige una plataforma de inversión en Forex en la que no tienes que sufrir ningún estrés en las operaciones, ella administra mi cuenta y todo lo que tengo que hacer es invertir capital y ella obtiene un poquito de Mis retornos como su comisión. Invertí 30 mil en criptomonedas y obtuve retornos de alrededor de $ 246 mil. La recomiendo ampliamente......49449949494949494949494949494949494949494949494949494994949449494949494949494949494949494949494944949494949494949494949494949494949
Josep Ramírez
Josep Ramírez Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
6595646466161616262662616266262662626616166112626262Un profesional financiero con el que trabaje realmente podría prepararlo para la vida. El hecho de que pude ponerme en contacto con mi entrenadora, gabriella_daniel_luz, a principios de este año me hace feliz ya que, mientras otros se quejaban de la economía, yo finalmente estaba ocupada cobrando, ganando más de 370 mil solo en el primer trimestre del año. . puedes enviarle un mensaje directo al (iiintst¿~<iragam).
Bożena Brooks
Bożena Brooks Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
222222222222222222225522252225...Siempre genial, me alegro de haber empezado a operar cuando lo hice porque fue un punto de inflexión para mí financieramente y fue la mejor decisión que tomé. Todo gracias a [[mar-ti-na..Ro-b£r-son]] en (iiintst¿~<iragam) sus habilidades son increíbles.....
Bożena Brooks
Bożena Brooks Hace 3 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
222222222222...Siempre genial, me alegro de haber empezado a operar cuando lo hice porque fue un punto de inflexión para mí financieramente y fue la mejor decisión que tomé. Todo gracias a [[mar-ti-na..Ro-b£r-son]] en (iiintst¿~<iragam) sus habilidades son increíbles.....2255800888555225588800885555555552252258088885522588852550088855555558888555558
Mohamed Blanco
Mohamed Blanco Hace 4 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
...La productividad nunca llega por accidente. Siempre es el resultado del compromiso y la constancia. Estoy agradecido a Dios por mi asesora, la Sra. Anna_skodaa en. (lIntstr-agam), con su ayuda soy financieramente estable y obtengo rendimientos de más de $200 000. No puedo. decir basta lo agradecido que estoy.....49449949494949494949494949494949494949494949494949494994949449494949494949494949494949494949494944949494949494949494949494949494949
Jesus Martin
Jesus Martin Hace 5 horas
Guardado. Ver Elementos guardados.
Este comentario ya está incluido en sus Elementos guardados
basura de spam. Solo oscurece la info que nos precisa
 
¿Estás seguro que quieres borrar este gráfico?
 
Publicar
 
¿Sustituir el gráfico adjunto por un nuevo gráfico?
1000
En estos momentos no le está permitido dejar comentarios debido a informes negativos de otros usuarios. Su estado será revisado por nuestros moderadores.
Por favor, espere un minuto antes de publicar otro comentario
Adjuntar un gráfico al comentario
Confirmar bloqueo

¿Está seguro de que desea bloquear a %USER_NAME%?

Al hacerlo, ni usted ni %USER_NAME% podrán ver las publicaciones del otro en Investing.com.

Se ha agregado correctamente a %USER_NAME% a su lista de usuarios bloqueados

Acaba de desbloquear a esta persona; tiene que esperar 48 horas para poder bloquearla de nuevo.

Denunciar este comentario

Díganos qué piensa de este comentario

Comentario denunciado

Gracias

Su denuncia será examinada por nuestros moderadores
Regístrese con Google
o
Regístrese con su email